Advertisement

Hepatoprotective effects of Diphenyl diselenide against acute ethanol intoxication in rats

Research Article | DOI: https://doi.org/10.31579/2834-5029/070

Hepatoprotective effects of Diphenyl diselenide against acute ethanol intoxication in rats

  • Mulikat Adenike Adewole 1,2
  • Ige Joseph Kade 2
  • Akeem Olalekan Lawal 2
  • Olusola Elekofehinti 2
  • Olatundun Oluwapelumi Fadiji 2*
  1. Department of Biochemistry, University of Medical sciences, Ondo, Ondo State, Nigeria.
  2. Department of Biochemistry, Federal University of Technology, Akure, Ondo State, Nigeria.

*Corresponding Author: Olatundun Oluwapelumi Fadiji, Department of Biochemistry, Federal University of Technology, Akure, Ondo State, Nigeria.

Citation: Mulikat Adenike Adewole, Ige Joseph Kade, Akeem Olalekan Lawal, Olusola Elekofehinti, Olatundun Oluwapelumi Fadiji. (2024), Hepatoprotective effects of Diphenyl diselenide against acute ethanol intoxication in rats, International Journal of Biomed Research, 3(6): DOI:10.31579/2834-5029/070

Copyright: © 2024, Olatundun Oluwapelumi Fadiji.. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: 12 October 2024 | Accepted: 28 October 2024 | Published: 15 November 2024

Keywords: social media; mental health; anxiety; minority; adolescents

Abstract

Ethanol intoxication often disrupts the antioxidant balance, leading to liver inflammation and alterations in purinergic enzyme activity. This makes any compound capable of restoring redox balance a potential therapeutic candidate. This study investigates the effects of diphenyl diselenide (DPDSe) on the thiol redox system, inflammatory gene expression, and purinergic enzyme activities in ethanol-intoxicated male Wistar rats. DPDSe (10 mg/kg) was administered orally 30 minutes before and after a single dose of 13 ml/kg (28% ethanol solution) was given. Antioxidant status, purinergic enzyme activities, and the expression of redox-sensitive genes were then assessed. Ethanol exposure led to increased lipid peroxidation, elevated Nucleotidase and NTPDase activities, and a reduction in thiol levels, along with the downregulation of Nrf2 and upregulation of NF-kB. Treatment with DPDSe reversed these biochemical and molecular changes. The ability of DPDSe to counteract ethanol-induced alterations in antioxidant status, inflammatory gene expression, and biochemical parameters suggests its potential as a therapeutic agent for ethanol-induced hepatotoxicity

Introduction

Ethanol intoxication has complex effects on living cells. To explore the molecular events associated with ethanol intoxication, several studies have focused on the role of redox-sensitive genes, such as Nrf2 and NF-kB. These genes have been shown to be modulated by ethanol, contributing to its inflammatory effects [26, 25]. Another mechanism by which ethanol induces toxicity is through the alteration of enzymes in the purinergic pathway. Enzymes such as 5’-nucleotidase and nucleoside triphosphate diphosphohydrolases (NTPDase), which are critical indicators of liver disease, are significantly affected by ethanol intoxication [19]. Research has documented that ethanol increases the activity of these enzymes in the platelet cell membrane, as they are sensitive to redox imbalances, with heightened activity observed during acute ethanol intoxication [5].

Although endogenous antioxidant systems provide some protection against oxidative damage, the excessive production of free radicals can overwhelm these systems, necessitating external sources of antioxidants. Exogenous antioxidants, such as flavonoids found in plants, have been shown to mitigate the effects of ethanol intoxication [6, 14]. Specifically, studies have demonstrated the protective effects of quercetin and green tea extracts on diseases linked to ethanol intoxication by reducing lipid oxidative damage and enhancing antioxidant enzyme activity [30, 29, 14]. These findings confirm that oxidative stress is a key mechanism of ethanol intoxication [4, 27], and the protective effects of phytochemicals are primarily due to their antioxidant capabilities. However, the use of plant-derived antioxidants poses challenges, including the potential for oxidation in the presence of oxygen and contamination with metals, which can turn them into pro-oxidants [16].

To address these issues, synthetic antioxidants have been explored and have shown effectiveness in reducing oxidative stress-related pathologies [3, 9]. For example, research into the antioxidative properties of organoselenium compounds has gained traction, as glutathione peroxidase (GPx), a potent endogenous enzymatic antioxidant, relies on selenocysteine at its active site for activity [23]. Diphenyl diselenide, one of the most studied organoselenium compounds, has demonstrated significant antioxidant properties [12, 17] and has been used to alleviate diseases related to oxidative stress [11, 12]. Studies have confirmed its ability to mimic glutathione peroxidase activity [21, 13], helping to reduce hydrogen peroxide and lipid peroxides to water and corresponding alcohols, similar to the action of endogenous GPx.

While diphenyl diselenide has been applied in the management of various oxidative stress-related pathologies, its effects on acute ethanol intoxication in male Wistar rats are not well understood. Therefore, this study aims to investigate the potential influence of diphenyl diselenide on acute ethanol intoxication in the liver of male Wistar rats.Top of Form

Introduction

Ethanol intoxication has complex effects on living cells. To explore the molecular events associated with ethanol intoxication, several studies have focused on the role of redox-sensitive genes, such as Nrf2 and NF-kB. These genes have been shown to be modulated by ethanol, contributing to its inflammatory effects [26, 25]. Another mechanism by which ethanol induces toxicity is through the alteration of enzymes in the purinergic pathway. Enzymes such as 5’-nucleotidase and nucleoside triphosphate diphosphohydrolases (NTPDase), which are critical indicators of liver disease, are significantly affected by ethanol intoxication [19]. Research has documented that ethanol increases the activity of these enzymes in the platelet cell membrane, as they are sensitive to redox imbalances, with heightened activity observed during acute ethanol intoxication [5].

Although endogenous antioxidant systems provide some protection against oxidative damage, the excessive production of free radicals can overwhelm these systems, necessitating external sources of antioxidants. Exogenous antioxidants, such as flavonoids found in plants, have been shown to mitigate the effects of ethanol intoxication [6, 14]. Specifically, studies have demonstrated the protective effects of quercetin and green tea extracts on diseases linked to ethanol intoxication by reducing lipid oxidative damage and enhancing antioxidant enzyme activity [30, 29, 14]. These findings confirm that oxidative stress is a key mechanism of ethanol intoxication [4, 27], and the protective effects of phytochemicals are primarily due to their antioxidant capabilities. However, the use of plant-derived antioxidants poses challenges, including the potential for oxidation in the presence of oxygen and contamination with metals, which can turn them into pro-oxidants [16].

To address these issues, synthetic antioxidants have been explored and have shown effectiveness in reducing oxidative stress-related pathologies [3, 9]. For example, research into the antioxidative properties of organoselenium compounds has gained traction, as glutathione peroxidase (GPx), a potent endogenous enzymatic antioxidant, relies on selenocysteine at its active site for activity [23]. Diphenyl diselenide, one of the most studied organoselenium compounds, has demonstrated significant antioxidant properties [12, 17] and has been used to alleviate diseases related to oxidative stress [11, 12]. Studies have confirmed its ability to mimic glutathione peroxidase activity [21, 13], helping to reduce hydrogen peroxide and lipid peroxides to water and corresponding alcohols, similar to the action of endogenous GPx.

While diphenyl diselenide has been applied in the management of various oxidative stress-related pathologies, its effects on acute ethanol intoxication in male Wistar rats are not well understood. Therefore, this study aims to investigate the potential influence of diphenyl diselenide on acute ethanol intoxication in the liver of male Wistar rats.Top of Form

Materials and Methods

Chemicals

Diphenyl diselenide, trichloroacetic acid (TCA), Dithiothretol (DTT), Tris’s salt, dithio-bis-(2-nitrobenzoic acid) DTNB, ethanol and other chemicals were gotten from Sigma Chemical Co. USA. Other chemicals were purchased from standard suppliers.

2.2              Experimental animals

Male adult Wistar rats (120-150 g) were purchased, acclimatised at the Animal House of the Department of Biochemistry, The Federal University of Technology, Akure, Nigeria, for 2 weeks and used in the entire experiment according to standard guidelines of the Committee on Care and Use of Experimental Animal Resources.

2.3              Estimation of ethanol influence on thiol oxidation induced by DPDSe in vitro. 

The influence of ethanol on the in vitro activity of diphenyl diselenide (DPDSe) induced thiol oxidation was carried out by measuring the formation of 2-nitro-5-thiobenzoic acid (TNB) at 412 nm.

2.4              Experimental Design (in vivo)

The study of DPDSe influence on acute intoxication by ethanol after 6 hours of treatment was carried out. The rats were divided into four groups (n=6) and allowed to acclimatize for two weeks, after which group 1 (Control) was administered distilled water, group 2 was treated with 10 mg/kg DPDSe only, group 3 induced with a single oral dose of 8 g/kg ethanol, group 4 was pretreated with 10 mg/kg DPDSe before induction with a single oral dose of 10ml/kg of 28% ethanol solution, after 30 minutes of pretreatment with DPDSe, the experiment was terminated 6 hours after the treatment with ethanol.

2.5              Lipid peroxidation assay

Lipid peroxidation was measured as thiobarbituric acid reactive substances (TBARS). TBARS were determined in tissue homogenates as previously described [18,22]. MDA values were determined using the absorbance coefficient (1.56 · 105 /cm/mmol) of the MDA–TBA complex at 532 nm.

2.6              Thiol oxidation

The thiol oxidation was determined in the presence of 50 mM Tris HCl pH 7.4 in both proteinized and deproteinized samples. The rate of thiol oxidation was evaluated by measuring the disappearance of SH-group. The free SH-group was determined by [7].

2.7              5’-Nucleotidase and NTPDase like activities.

The 5’-Nucleotidase activity was determined in a reaction medium essentially as described by [10]. The reaction was initiated by the addition of AMP and ATP to a final concentration of 2.0 mM for both enzymes (NTPDase and 5’-Nucleotidase) respectively. The assays were stopped by the addition of 250 µl of 10% trichloroacetic acid (TCA). Inorganic phosphate was measured by the method of [8]. Control experiments were carried to correct for non-enzymatic hydrolysis of the nucleotides. All samples were run in duplicate and Enzyme-specific activities are reported as nmol Pi released/min/mg of protein.

2.8              Gene expression analysis using real-time quantitative polymerase reaction 

TRI Reagent (Zymo Research, USA) was used to extract total RNA from the tissues. 1 mg of RNA was used to make cDNA in a three-step reverse transcriptase reaction with the ProtoScript II First Strand cDNA Synthesis Kit (BioLabs, New England) at 65 ◦C for 5 min, 42 ◦C for 1 h, and 80 ◦C for 5 min. Table 1 lists the rat cDNA primers (Inqaba Biotec, Hatfield, SA) that were utilized for PCR. Solis BioDyne Reverse Transcriptase RT qPCR System and FIREPol ® Master Mix (BioLabs, New England) were used to perform real-time quantitative PCR (RT-qPCR) according to the manufacturer’s instructions. The following were the PCR conditions: 95 ◦C for 3 min, followed by 40 cycles of 95 ◦C for 15 s, 60 ◦C for 30 s, and 72 ◦C for 30 s. The relative quantity of cDNA was measured using the comparative cycle threshold (DDCT) method. The relative expression level of each gene was normalized using the β-actin gene.

2.9              Statistical analysis

 The results of replicate readings were pooled and expressed as mean ± standard deviation (S.D). One-way Analysis of Variance (ANOVA) was used to analyze the results followed by Turkey’s post hoc test, with levels of significance accepted at p < 0.05. All statistical analyses were carried out using the software Graph pad PRISM (V.5.0).

TABLE 1

Primer sequence for Real - time quantitative PCR

S/N                                          Gene                                                       Sequence

1                                              β-actin                     Forward: CTCCCTGGAGAAGAGCTATGA 

Reverse: AGGAAGGAAGGCTGGAAGA

2                                              NFKB                     Forward: AGACATCCTTCCGCAAACTC 

Reverse: TAGGTCCATCCTGCCCATAA

3                                              Nrf2                         Forward: ACGTGATGAGGATGGGAAAC 

Reverse: TATCTGGCTTCTTGCTCTTGG

 

3.0. Results

3.1           Influence of Acute Ethanol Intoxication and Diphenyl Diselenide on Biochemical Indices of Oxidation Stress.                

3.1.1        Influence of DPDSe on ethanol-induced reduction in total thiol level in vivo

Fig. 3.1.1 shows that ethanol intoxication causes reduction in total thiol level and that both pre-and post-DPDSe treatment markedly (p<0>in vivo thiol level.

3.1.2       Influence of DPDSe on ethanol-induced lipid peroxidation 

Fig. 3.1.2 shows that DPDSe pre-treatment markedly mitigates ethanol induced lipid peroxidation in ethanol intoxicated rats while post- treatment has no significant effect on lipid peroxidation induced by ethanol intoxication.

3.1.3     Influence of DPDSe on ethanol-induced reduction in non-protein thiol

Fig. 3.1.3 shows that ethanol intoxication causes reduction in non-protein thiol and that both pre- and post- DPDSe treatments markedly reverse the ethanol- induced decrease in the in vivo thiol level.

3.1.4     Influence of DPDSe on ethanol-induced elevated NTPDase activity

Fig. 3.1.4 shows that ethanol intoxication causes elevation in NTPDase activity and that both pre- and post- DPDSe treatments markedly decreases the activity of the enzyme.

3.1.5     Influence of DPDSe on ethanol-induced elevated Nucleotidase activity

Fig. 3.1.5 shows that ethanol intoxication causes elevation in Nucleotidase activity and that both pre- and post-DPDSe treatments markedly decrease the activity of the enzyme.

 

 

Fig.3.1.1 Influence of DPDSe pre- and post- treatment on total thiol level in liver of acute ethanol-intoxicated male Wistar rats. ap<0>

 

Fig.3.1.2 Influence of DPDSe pre- and post- treatment on lipid peroxidation in liver of acute ethanol-intoxicated male Wistar rats. ap<0>

 

 

 

 

Fig.3.1.3 Influence of DPDSe pre- and post- treatment on non-protein thiol level in liver of acute ethanol-intoxicated male Wistar rats. ap<0>

 

Figure 3.1.4 Influence of DPDSe pre- and post- treatment on activity of NTPDase in liver of acute ethanol-intoxicated male Wistar rats. ap<0>

 

 

 

Fig.3.1.5 Influence of DPDSe pre- and post- treatment on the activity of Nucleotidase in liver of acute ethanol-intoxicated male Wistar rats. ap<0>

 

3.2            Influence of Diphenyl Diselenide and Alcohol on Expression of Antioxidant and Pro-Inflammatory Genes.

3.2.1    Influence of DPDSe on ethanol-induced downregulation of Nrf2

Fig. 3.2.1 shows that ethanol intoxication causes a downregulation in the expression of Nrf2 and that post treatment of the animals with DPDSe markedly upregulate the expression of the gene while the DPDSe pretreatment do not have any stimulatory effect on the expression of the gene.

 

    
 
  
  
   

 

 

Figure. 3.2.1 Influence of DPDSe pre- and post- treatment on Nrf2 in liver of acute ethanol-intoxicated male Wistar rats. ap<0>

 

     

NFKB

 

                β-Actin

 

 

 

  
 

 

 

Figure 3.2.2 Influence of DPDSe pre- and post- treatment on NFKB in liver of acute ethanol-intoxicated male Wistar rats. ap<0>

Discussion

Redox imbalance is a hallmark of ethanol intoxication in the liver of male Wistar rats, and diphenyl diselenide (DPDSe) has been shown to improve antioxidant status, reverse altered activities of purinergic enzymes, and modulate the expression of redox-sensitive genes. When the redox balance shifts in favor of oxidants, macromolecules such as lipids, proteins, and DNA are vulnerable to oxidative damage, which is a key indicator of oxidative stress [1, 24]. Lipid oxidative damage occurs when reactive oxygen species (ROS) abstract hydrogen from polyunsaturated fatty acids (PUFAs), leading to lipid peroxidation and subsequent cell membrane damage. This process releases malondialdehyde (MDA) and other reactive aldehydes, which form adducts with thiobarbituric acid (TBA). The MDA-TBA adduct can be measured spectrophotometrically at 532 nm to quantify the extent of lipid peroxidation. In this study, elevated thiobarbituric acid reactive substances (TBARS) were observed in ethanol-treated animals, which were significantly reduced by DPDSe treatment. The high TBARS levels in the ethanol group indicate that lipid biomolecules were oxidatively damaged, while the reduction in TBARS in the DPDSe-treated group suggests that DPDSe either enhanced antioxidant defense or repaired oxidative damage by donating hydrogen to stabilize PUFAs.

In addition to measuring oxidative stress through lipid peroxidation and antioxidant capacity, assessing the activities of redox-responsive enzymes offers further insight. 5’-nucleotidase (5NT) and nucleoside triphosphate diphosphohydrolases (NTPDases) are crucial enzymes involved in nucleotide metabolism and are known to respond to oxidative stress. Their dysregulation can lead to various pathological conditions, making them targets for therapeutic interventions. Increased activities of these enzymes have been linked to ethanol-induced oxidative stress, with serum 5NT levels being a marker of hepatobiliary disease [19]. Consistent with previous studies, this research demonstrated increased activities of 5’-nucleotidase and NTPDase in the liver of ethanol-intoxicated rats, likely due to elevated levels of NADH driving ATP production and, in turn, increasing purinergic enzyme activity. However, DPDSe treatment reduced the activities of these enzymes.

To investigate the mechanism by which DPDSe mitigates oxidative damage, the antioxidant capacity of untreated ethanol-intoxicated animals was compared with pre- and post-DPDSe-treated animals by measuring reduced glutathione (GSH) levels. Since over 90% of non-protein thiols in rats are GSH [20], the observed decrease in thiol levels in ethanol-treated animals suggests that thiols were consumed in stabilizing ethanol-induced free radicals. This finding aligns with previous studies showing that thiol oxidation is a key event in ethanol intoxication [28]. Both pre- and post-DPDSe treatments elevated thiol levels, indicating that DPDSe either prevented thiol depletion or repaired oxidative damage by halting lipid peroxidation, thus sparing thiol groups. This confirms that ethanol intoxication is linked to oxidative stress and supports the antioxidant and hepatoprotective potential of DPDSe in mitigating ethanol-induced liver damage.

Many endogenous antioxidants are gene products, and the protective effects of DPDSe against ethanol-induced oxidative stress may also occur at the molecular level. To explore this, the expression of the antioxidant gene Nrf2 was evaluated. Nrf2 is crucial in regulating antioxidant defenses and responding to oxidative insults [15]. In ethanol-intoxicated rats, Nrf2 expression was downregulated, indicating that ethanol impairs the cell’s endogenous defense system at the molecular level, consistent with previous reports [2]. However, DPDSe treatment restored Nrf2 expression, showing that DPDSe can modulate cellular defense systems compromised by ethanol intoxication.

To further understand the molecular effects of ethanol on inflammation, the expression of nuclear factor kappa B (NF-kB), a key component of the inflammatory pathway, was assessed. Ethanol intoxication upregulated NF-kB expression, while post-treatment with DPDSe reduced its expression, highlighting the anti-inflammatory potential of DPDSe.

Overall, this study demonstrates that DPDSe significantly reduces oxidative stress markers such as TBARS, downregulates NF-kB expression, increases total and non-protein thiol levels, and upregulates Nrf2 expression in the liver of ethanol-intoxicated rats. These findings confirm DPDSe's potent antioxidant and anti-inflammatory properties, effectively reversing ethanol-induced oxidative damage.

Conclusion

Acute ethanol exposure remains a challenge due to its well-documented toxicity, despite its known health benefits. This study reveals several toxic mechanisms of ethanol, including thiol oxidation, lipid peroxidation, downregulation of the antioxidant gene Nrf2, and upregulation of inflammatory pathways via NF-kB. Diphenyl diselenide (DPDSe) has emerged as a promising agent for mitigating these toxic effects. It effectively reverses ethanol-induced oxidative stress by modulating redox-sensitive transcription factors such as Nrf2 and NF-kB, reducing oxidative stress markers like TBARS, and enhancing antioxidant capacity by preserving non-protein and total thiol levels. Additionally, DPDSe ameliorates the effects on purinergic enzymes, further supporting its potential as a therapeutic agent in managing the oxidative damage and inflammation associated with acute ethanol intoxication.

Statements And Declarations

The authors did not receive funding support from any organization for the submitted work.
The authors have no relevant financial or non-financial interest to declare.
All authors contributed to the study conception and design of the research work. 

References

Clinical Trials and Clinical Research: I am delighted to provide a testimonial for the peer review process, support from the editorial office, and the exceptional quality of the journal for my article entitled “Effect of Traditional Moxibustion in Assisting the Rehabilitation of Stroke Patients.” The peer review process for my article was rigorous and thorough, ensuring that only high-quality research is published in the journal. The reviewers provided valuable feedback and constructive criticism that greatly improved the clarity and scientific rigor of my study. Their expertise and attention to detail helped me refine my research methodology and strengthen the overall impact of my findings. I would also like to express my gratitude for the exceptional support I received from the editorial office throughout the publication process. The editorial team was prompt, professional, and highly responsive to all my queries and concerns. Their guidance and assistance were instrumental in navigating the submission and revision process, making it a seamless and efficient experience. Furthermore, I am impressed by the outstanding quality of the journal itself. The journal’s commitment to publishing cutting-edge research in the field of stroke rehabilitation is evident in the diverse range of articles it features. The journal consistently upholds rigorous scientific standards, ensuring that only the most impactful and innovative studies are published. This commitment to excellence has undoubtedly contributed to the journal’s reputation as a leading platform for stroke rehabilitation research. In conclusion, I am extremely satisfied with the peer review process, the support from the editorial office, and the overall quality of the journal for my article. I wholeheartedly recommend this journal to researchers and clinicians interested in stroke rehabilitation and related fields. The journal’s dedication to scientific rigor, coupled with the exceptional support provided by the editorial office, makes it an invaluable platform for disseminating research and advancing the field.

img

Dr Shiming Tang

Clinical Reviews and Case Reports, The comment form the peer-review were satisfactory. I will cements on the quality of the journal when I receive my hardback copy

img

Hameed khan